The Hb Tarrant [alpha126(H9)Asp-->Asn]] mutation is localized in the alpha2-globin gene

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection.

Revista espanola de cirugia ortopedica y traumatologia (English ed.)·2019

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

International journal of paleopathology·2018

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

International journal of laboratory hematology·2017

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

International journal of pharmaceutics·2017

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

International journal of laboratory hematology·2016

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Genetics and molecular research : GMR·2015

Hemoglobin E Associated with Hemoglobin Constant Spring: Diagnostic Challenges in Heterozygous and Homozygous States.

Hemoglobin·2026

An Unusual Presentation of Erythrocytosis Resulting in the Identification of a Novel Unstable Hemoglobin Variant: Hb Koskullskulle HBB: C.311T > C (p.Phe104Ser).

Hemoglobin·2026

Hematologic Indices of Hemoglobin D Co-Inheritance with α and β Thalassemia: A Comparative Study of 202 Patients.

Hemoglobin·2026

The Efficiency of Capillarys 2 Flex Piercing, Premier Resolution-HPLC, and VARIANT II-HPLC for Hemoglobin Constant Spring Detection.

Hemoglobin·2026

Tailoring Genetic Approaches for Easier Detection of Anti-3.7 Alpha-Globin Gene Triplication in the Iranian Population.

Hemoglobin·2026

Microcytic Anemia with Low HbA2 and Normal HbA: Two Cases of Rare Thalassemia.

Hemoglobin·2026

Progress in Synthesis and Pharmacology of Telmisartan.

Chemistry & biodiversity·2026

Functional psychosurgery in psychiatry: indications and preoperative evaluation. A narrative review.

Frontiers in psychiatry·2026

Development of humanized mouse models for the preclinical evaluation of NK cell-based therapies.

Frontiers in immunology·2026

Focused Ultrasound is Poised to Take Non-Viral Gene Therapies to the Blood-Brain Barrier - and Beyond.

Cell biomaterials·2026

pAc/Emm55 increases anti-melanoma immunity via TLR2 signaling in dendritic cells and improves checkpoint blockade efficacy.

Frontiers in immunology·2026

Exposure-response and dose simulation of belantamab mafodotin in combination with standards of care in patients with relapsed/refractory multiple myeloma.

Haematologica·2026

Related Experiment Videos

The Hb Tarrant [alpha126(H9)Asp-->Asn]] mutation is localized in the alpha2-globin gene

Related Concept Videos

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection.

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Hemoglobin E Associated with Hemoglobin Constant Spring: Diagnostic Challenges in Heterozygous and Homozygous States.

An Unusual Presentation of Erythrocytosis Resulting in the Identification of a Novel Unstable Hemoglobin Variant: Hb Koskullskulle HBB: C.311T > C (p.Phe104Ser).

Hematologic Indices of Hemoglobin D Co-Inheritance with α and β Thalassemia: A Comparative Study of 202 Patients.

The Efficiency of Capillarys 2 Flex Piercing, Premier Resolution-HPLC, and VARIANT II-HPLC for Hemoglobin Constant Spring Detection.

Tailoring Genetic Approaches for Easier Detection of Anti-3.7 Alpha-Globin Gene Triplication in the Iranian Population.

Microcytic Anemia with Low HbA2 and Normal HbA: Two Cases of Rare Thalassemia.

Progress in Synthesis and Pharmacology of Telmisartan.

Functional psychosurgery in psychiatry: indications and preoperative evaluation. A narrative review.

Development of humanized mouse models for the preclinical evaluation of NK cell-based therapies.

Focused Ultrasound is Poised to Take Non-Viral Gene Therapies to the Blood-Brain Barrier - and Beyond.

pAc/Emm55 increases anti-melanoma immunity via TLR2 signaling in dendritic cells and improves checkpoint blockade efficacy.

Exposure-response and dose simulation of belantamab mafodotin in combination with standards of care in patients with relapsed/refractory multiple myeloma.

Related Experiment Videos

The Hb Tarrant [alpha126(H9)Asp-->Asn]] mutation is localized in the alpha2-globin gene

Related Concept Videos

Related Articles