Related Experiment Videos
[Preparation of Streptococcus sanguis DIG-labeled DNA probes and clinical application]
Objective:
To investigate oral Streptococci nif gene.
Methods:
According to the 800 base pairs(bp) sequence, a couple of special prime was designed, which were 5'TAGTTGAAGCGATTAAAGCG 3' and 5' TCGTCGTGAAAGCCAAA 3'. DIG-labeled DNA probes of ATCC10556 800 bp DNA fragment and 559 bp DNA fragment were made. By using Southern blotting and dot blotting, more than 30 bacterial strains were checked.
Results:
559 bp sequence was according with the reported results, and the Southern blot results showed that S34 sr, S34 no 1 strains had homologicous sequence with ATCC10556, two strains of Streptococcus sanguis were weak positive, and other strains were negative.
Conclusion:
Streptococcus sanguis ATCC10556 strain contained exactly nif gene and nif gene may be the special gene of Streptococcus sanguis ATCC 10556.