Related Experiment Videos
Nucleotide sequence of the Urechis caupo core histone gene tandem repeat
F C Davis1, J C Shelton, L D Ingham
1Department of Microbiology and Cell Science, University of Florida, Gainesville 32611-0144.
Abstract:
The 4942 bp nucleotide sequence of a repeating unit from the core histone gene tandem repeat of Urechis caupo and the predicted amino acid sequence of the four core histones are presented. Putative promoter elements including the CAP site and TATA box as well as multiple CAAT-like sequences are identified upstream from each gene. Upstream from each core histone gene are 26 or 30 bp sequences that may have a promoter function and appear to be unique to Urechis histone genes. Located 5' to both H2A and H2B is the 26 bp sequence, GGTCATGTGACTCTAATACCGCGCTG. An identical, but inverted, 26 bp sequence is present upstream of H4. Upstream from the H3 gene, two regions of a 30 bp sequence, GGTCTTGTGGCGGGAACAAATACCGCAACG, are very similar to corresponding regions of the 26 bp sequence. Additional 10 bp conserved sequences, CAGCGGGCGC, are present only upstream from the H2A and H2B genes. Conserved sequences containing a region of dyad symmetry followed by a purine-rich sequence that are typical of histone mRNA termination sites are present 27 to 36 bp 3' from the termination codon. Short repetitive DNA sequence elements are present in the spacer sequences between the H2A and H3 genes and the H2B and H4 gene.