Related Experiment Video
Updated: Aug 30, 2026

Direct Reprogramming of Human Fibroblasts into Myoblasts to Investigate Therapies for Neuromuscular Disorders
Published on: April 3, 2021
High efficiency transduction of human VEGF165 into human skeletal myoblasts: in vitro studies
Lei Ye1, Husnain Kh Haider, Shujia Jiang
1Department of Cardiothoracic and Vascular Surgery, National University of Singapore, Singapore-117597.
Abstract:
We report the transduction of human VEGF165 gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF165 was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF165 specific primers (5'-3' = 5'ATGAACTTTCTGCTGTCTTGGGTG and 3'-5' = ACACCGCCTCGGCTTGTCACA3'. Biological activity of the secreted VEGF165 was determined by human umbilical vein endothelial cell proliferation and [H3] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF(165) positive myoblasts. Western blotting and ELISA revealed high VEGF165 expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF165 released in the culture medium peaked (37 +/- 3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF165 transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF165 antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300 +/- 50 pg/ml) that is enhanced many folds (37 +/- 3 ng/ml) in VEGF165 transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF165 to achieve concurrent angiomyogenesis for cardiac repair.

