[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus]

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.