Related Experiment Video
Updated: Aug 15, 2026

DNA Nanotubes as a Versatile Tool to Study Semiflexible Polymers
Published on: October 25, 2017
Internal versus terminal metalation of double-helical oligodeoxyribonucleotides
1Centre of Pharmacy, Department of Chemistry, University of Bergen, Norway. jo.vinje@kj.uib.no
Abstract:
The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.
Related Concept Videos
Nucleic Acid Structure
DNA Structure
DNA has a double-helix structure. The...
Sanger Sequencing
Tail-anchoring of Proteins in the ER Membrane
Olefin Metathesis Polymerization: Acyclic Diene Metathesis (ADMET)
Similar to cross-metathesis, ADMET also involves the formation of metallacyclobutane intermediate by [2+2] cycloaddition of one of the double bonds of a terminal diene with...
Translesion DNA Polymerases
TLS polymerases are found in all three domains of life - archaea, bacteria, and eukaryotes. Of the different classes of TLS polymerases, members of the Y family are fitted with specialized structures that...
EDTA: Chemistry and Properties

