Related Experiment Video
Updated: Aug 7, 2026

Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease
Published on: April 4, 2018
Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1)
Su-Ryang Kim1, Yoshiro Saito, Keiko Maekawa
1Project Team for Pharmacogenetics, National Institute of Health Sciences, Tokyo 158-8501, Japan. kim@nihs.go.jp
Abstract:
Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.
More Related Videos
06:21Multi-Gene Single Nucleotide Polymorphism Detection in Gastric Cancer Based on Ion Semiconductor Sequencing Platform
Published on: May 10, 2024
07:15Determining the Likelihood of Variant Pathogenicity Using Amino Acid-level Signal-to-Noise Analysis of Genetic Variation
Published on: January 16, 2019
Related Concept Videos
Pharmacogenetics of Drug Transporters: P-Glycoprotein and Solute Carrier Transporters
Glucose Transporters
Facilitated diffusion-glucose transporters (GLUTs) are encoded by the solute-linked carrier (SLC) family 2, subfamily A gene family, or SLC2A. The 14 GLUT protein members are distributed into three classes:
Principles of Pharmacogenetics: Types of Genetic Variants
The Significance of Membrane Transport
Transporters facilitate either an active or passive movement of solutes. They can allow a single-molecule transport down its...
Membrane Transporters
Transporters are mainly composed of alpha-helices, built from bundles of ten or more helices traversing the plasma membrane. The solute-binding sites are located midway, where some of the helices are broken or distorted, making space for the binding site through...
Pharmacogenetics of Phase II Enzymes: N-acetyltransferase, Thiopurine S-methyltransferase, UDP-glucuronosyltransferase