Related Experiment Video
Updated: Jul 14, 2026

Luminophore Formation in Various Conformations of Bovine Serum Albumin by Binding of Gold(III)
Published on: August 31, 2018
Analysis of interaction between dendriplexes and bovine serum albumin
Dzmitry Shcharbin1, Elzbieta Pedziwiatr, Louis Chonco
1Department of General Biophysics, University of Lodz, Lodz, Poland. shcharbi@biol.uni.lodz.pl
Abstract:
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.
