Related Experiment Video
Updated: Jun 28, 2026

Detection and Quantification of Mono-Rhamnolipids and Di-Rhamnolipids Produced by Pseudomonas aeruginosa
Published on: March 29, 2024
Rapid detection and quantification of Propionibacteriaceae
P Goldschmidt1, C Costa Ferreira, S Degorge
1Laboratoire du Centre National d'Ophtalmologie des Quinze-Vingts, 28 rue de Charenton, Paris, France. pablogol@aol.com
Background:
Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).
Material And Methods:
DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube.
Results:
This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.
Conclusion:
The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.
Insights
A new real-time PCR test rapidly and sensitively detects Propionibacteriaceae (Propioni) infections. This method identifies as little as 0.01 Eq/CFU microl of Propioni in various samples within 1.5 hours.
Area of Science:
- Microbiology
- Molecular Diagnostics
- Infectious Diseases
Background:
- Propionibacteriaceae (Propioni) are anaerobic bacteria implicated in human and animal infections.
- Current diagnostic methods for Propioni infections lack sensitivity, are time-consuming (3-14 days), and present interpretation challenges.
- Existing diagnostic limitations necessitate the development of rapid and sensitive detection methods.
Purpose of the Study:
- To validate a novel, rapid, and sensitive diagnostic test for Propionibacteriaceae infections.
- To establish a new molecular assay for the early detection of Propioni in clinical samples.
- To improve the diagnosis of Propioni-associated conditions like endophthalmitis and corneal ulcers.
Main Methods:
- DNA extraction using the MagNA Pure isolation kit (Roche).
- Development and application of original primers and a probe for bacterial detection and quantification via real-time PCR.
- Utilized a PCR cycling program with specific temperature and time parameters for efficient amplification.
Main Results:
- The developed real-time PCR assay demonstrates high sensitivity, detecting as low as 0.01 Equivalent PFU/microl of Propioni.
- The test effectively detects Propioni in various matrices, including phosphate-buffered saline (PBS), aqueous humor, vitreous humor, and cell suspensions.
- Propionibacteriaceae were detected as single contaminants or in mixed infections with other microorganisms or human cells.
Conclusions:
- The new real-time PCR assay provides a rapid diagnostic solution for Propionibacteriaceae infections, with results available in under 1.5 hours.
- The assay achieves high sensitivity, detecting 0.01 Eq/CFU microl of Propioni in diverse biological samples.
- This validated method offers a significant improvement over traditional diagnostic techniques for Propioni detection.
More Related Videos
07:59Rapid and Specific Detection of Acinetobacter baumannii Infections Using a Recombinase Polymerase Amplification/Cas12a-based System
Published on: April 25, 2025
11:09Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres
Published on: October 23, 2011
Related Concept Videos
Rapid Identification of Pathogens
Methods to Assess Microbial Populations
Real Time RT-PCR
The real-time quantification of the number of amplified products is...