Related Experiment Video
Updated: Jun 14, 2026

Single-Molecule Fluorescence Visualization of DNA Polymerase Dynamics at G-Quadruplexes
Published on: April 4, 2025
The fluorescence properties and lifetime study of G-quadruplexes single- and double-labeled with pyrene
Anna Dembska1, Bernard Juskowiak
1Department of Chemistry, A.Mickiewicz University, Grunwaldzka 6, 60-780, Poznan, Poland.
Abstract:
We report steady state fluorescence and lifetime emission studies of d(GGTTGGTGTGGTTGG) (TBA) and d(GGGTTAGGGTTAGGGTTAGGG) (Htelom) oligonucleotides labeled with pyrene through a 3-aminopropyl linker. Such G-rich sequences are able to self-assemble into G-quadruplexes, especially in the presence of specific cations like potassium. A comparative studies with single- and double-labeled G-quadruplexes were carried out. For each probe we have measured fluorescence decays for emission wavelength of 390 and 480 nm in the varying concentration of potassium ion. We have calculated average lifetimes <τ> for every system as well as the fractional distribution α(i) of emitting species.
More Related Videos
Related Concept Videos
Labeling DNA Probes
Radioisotopes, fluorophores, or small molecule binding partners like biotin or digoxigenin, are the most widely used reporter tags for labeling DNA probes. These labels can be attached to the probe DNA molecule via...
Protein Dynamics in Living Cells
Fluorescent recovery after photobleaching (FRAP) is a fluorescent-protein-based detection technique used to quantify protein movement rates within the cell. This method exposes a small portion of the cell to an intense laser beam. The laser beam causes permanent photobleaching of the fluorophore-tagged proteins in the exposed region. As the bleached...
Variables Affecting Phosphorescence and Fluorescence

