Related Experiment Video
Updated: Jun 13, 2026

Iterative Optimization of DNA Duplexes for Crystallization of SeqA-DNA Complexes
Published on: November 1, 2012
Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a
1Department of Life Science, Dongguk University-Seoul, 26 Pil-dong 3-ga, Jung-gu, Seoul 100-715, Republic of Korea.
Abstract:
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Related Concept Videos
The DNA Helix
The DNA Helix
DNA as a Genetic Template
Maxam-Gilbert Sequencing
Challenges of the Maxam-Gilbert Method
The...
Single-Strand DNA Binding Proteins
Sanger Sequencing

