Jove
Visualize
Contact Us
JoVE
x logofacebook logolinkedin logoyoutube logo
ABOUT JoVE
OverviewLeadershipBlogJoVE Help Center
AUTHORS
Publishing ProcessEditorial BoardScope & PoliciesPeer ReviewFAQSubmit
LIBRARIANS
TestimonialsSubscriptionsAccessResourcesLibrary Advisory BoardFAQ
RESEARCH
JoVE JournalMethods CollectionsJoVE Encyclopedia of ExperimentsArchive
EDUCATION
JoVE CoreJoVE BusinessJoVE Science EducationJoVE Lab ManualFaculty Resource CenterFaculty Site
Terms & Conditions of Use
Privacy Policy
Policies

Related Concept Videos

Leishmaniasis01:30

Leishmaniasis

Leishmaniasis is a protozoal disease caused by species of the genus Leishmania and transmitted through the bite of infected female sandflies. The parasite exists in two principal morphological forms during its life cycle. A sandfly acquires intracellular amastigotes from an infected reservoir host, such as a dog. Within the sandfly, these forms differentiate into motile, flagellated promastigotes. During a subsequent blood meal, promastigotes are injected into the human host, where they...
Pulmonary Tuberculosis II01:28

Pulmonary Tuberculosis II

Tuberculosis, or TB, is a bacterial infectious disease caused by Mycobacterium tuberculosis. While its primary impact is on the lungs, leading to pulmonary tuberculosis, it can also affect various other organs, a condition referred to as extrapulmonary tuberculosis.
Here is a detailed explanation of its pathophysiology:
Transmission: The process begins when a person inhales droplet nuclei containing M. tuberculosis. These are typically released into the air when an individual with pulmonary or...
Tuberculosis01:23

Tuberculosis

Tuberculosis (TB) remains a significant global health concern, primarily targeting the lungs and spreading through airborne transmission. Infection begins when aerosolized droplet nuclei, expelled by an individual with active TB, are inhaled by another person. These microscopic particles carry Mycobacterium tuberculosis, the causative agent of TB. Upon reaching the alveoli, the bacilli are engulfed by alveolar macrophages. However, due to their specialized lipid-rich cell wall, these pathogens...
Pulmonary Tuberculosis III01:31

Pulmonary Tuberculosis III

Tuberculosis (TB) is a contagious infection primarily affecting the lung parenchyma but which can also affect other body parts. TB can be classified based on disease development, presentation, and the affected anatomical site.
The first classification is based on the development of the disease, and it includes the following categories:
Pulmonary Tuberculosis I01:29

Pulmonary Tuberculosis I

Tuberculosis, often called TB, is a contagious illness primarily caused by Mycobacterium tuberculosis. It mainly affects the lung parenchyma but can also impact other body parts.
Causative Organism
The primary infectious agent causing tuberculosis is Mycobacterium tuberculosis, a slow-growing, acid-fast, aerobic rod that exhibits sensitivity to heat and ultraviolet light. Instances of Mycobacterium bovis and Mycobacterium avium contributing to the development of TB infection are rare.
Mode of...
Pulmonary Tuberculosis V01:28

Pulmonary Tuberculosis V

Medical management of tuberculosis (TB) patients involves a comprehensive approach that includes diagnosis, treatment, and monitoring. The specific strategies can vary depending on the type of tuberculosis (latent or active), the patient's overall health status, and other considerations.
Latent tuberculosis infection occurs when TB bacteria are present in a person's body, but are not causing illness or symptoms. It is not contagious, and preventive treatment is crucial to avoid the progression...

You might also read

Related Articles

Articles linked to this work by shared authors, journal, and citation graph.

Sort by
Same author

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection.

Revista espanola de cirugia ortopedica y traumatologia (English ed.)·2019
Same author

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

International journal of paleopathology·2018
Same author

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

International journal of laboratory hematology·2017
Same author

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

International journal of pharmaceutics·2017
Same author

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

International journal of laboratory hematology·2016
Same author

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Genetics and molecular research : GMR·2015

Related Experiment Video

Updated: Jun 7, 2026

Optimized Protocols for Mycobacterium leprae Strain Management: Frozen Stock Preservation and Maintenance in Athymic Nude Mice
10:32

Optimized Protocols for Mycobacterium leprae Strain Management: Frozen Stock Preservation and Maintenance in Athymic Nude Mice

Published on: March 23, 2014

Leprosy in HAVANA

B IBARRA, M A GONZALEZ PRENDES

    Revista De Sifilografia, Leprologia Y Dermatologia
    |October 29, 2010
    PubMed
    Summary

    No abstract available in PubMed .

    Keywords:
    LEPROSY/epidemiology and statistics

    More Related Videos

    Cutaneous Leishmaniasis in the Dorsal Skin of Hamsters: a Useful Model for the Screening of Antileishmanial Drugs
    11:36

    Cutaneous Leishmaniasis in the Dorsal Skin of Hamsters: a Useful Model for the Screening of Antileishmanial Drugs

    Published on: April 21, 2012

    In Vivo Imaging of Leishmania infantum-infected Hamsters by Gingival Inoculation of Axenic Amastigotes Expressing Luciferase
    05:55

    In Vivo Imaging of Leishmania infantum-infected Hamsters by Gingival Inoculation of Axenic Amastigotes Expressing Luciferase

    Published on: April 4, 2025

    Related Experiment Videos

    Last Updated: Jun 7, 2026

    Optimized Protocols for Mycobacterium leprae Strain Management: Frozen Stock Preservation and Maintenance in Athymic Nude Mice
    10:32

    Optimized Protocols for Mycobacterium leprae Strain Management: Frozen Stock Preservation and Maintenance in Athymic Nude Mice

    Published on: March 23, 2014

    Cutaneous Leishmaniasis in the Dorsal Skin of Hamsters: a Useful Model for the Screening of Antileishmanial Drugs
    11:36

    Cutaneous Leishmaniasis in the Dorsal Skin of Hamsters: a Useful Model for the Screening of Antileishmanial Drugs

    Published on: April 21, 2012

    In Vivo Imaging of Leishmania infantum-infected Hamsters by Gingival Inoculation of Axenic Amastigotes Expressing Luciferase
    05:55

    In Vivo Imaging of Leishmania infantum-infected Hamsters by Gingival Inoculation of Axenic Amastigotes Expressing Luciferase

    Published on: April 4, 2025