Related Experiment Video
Updated: Jun 7, 2026

Neutron Crystallography Data Collection and Processing for Modelling Hydrogen Atoms in Protein Structures
Published on: December 1, 2020
Combined neutron and X-ray diffraction studies of DNA in crystals and solutions
Ricardo M F Leal1, Shirley Callow, Phil Callow
1European Synchrotron Radiation Facility, 6 Rue Jules Horowitz, 38043 Grenoble, France.
Abstract:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Related Concept Videos
X-ray Diffraction of Biological Samples
According to Bragg's law, when X-rays strike the sample positioned on a stage, the rays are scattered by the electron clouds around the sample atoms. The X-ray diffraction or scattering is caused by constructive interference of the X-ray waves that reflect off the internal crystal...
Determination of Crystal Structures
X-ray Crystallography
Diffraction
Diffraction is the change in the direction of travel experienced by an electromagnetic wave when it encounters a physical barrier whose dimensions are comparable to those of the wavelength of the light. X-rays are electromagnetic radiation with wavelengths about as long as the distance between neighboring...
The DNA Helix
The DNA Helix
DNA as a Genetic Template

