Related Experiment Video
Updated: May 16, 2026

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events
Published on: May 13, 2019
5'-Terminal chemical capping of spliced leader RNAs
Karolina Piecyk1, Richard E Davis, Marzena Jankowska-Anyszka
1Faculty of Chemistry, University of Warsaw, 02-093, Warsaw, Poland.
Abstract:
Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.
Related Concept Videos
Pre-mRNA Processing: Modification of pre-mRNA Ends
Once about 20-40 ribonucleotides have been joined together by RNA polymerase, a group of enzymes adds a cap to the 5' end of the growing transcript. In this process, a 5' phosphate is replaced by modified guanosine that has a methyl group attached (7-methyl guanosine). This 5' cap helps the cell...
pre-mRNA Processing
Once about 20-40 ribonucleotides have been joined together by RNA polymerase, a group of enzymes adds a “cap” to the 5’ end of the growing transcript. In this process, a 5’ phosphate is replaced by modified guanosine that has a methyl group attached to it (7-Methyl guanosine). This 5’ cap helps the...
Pre-mRNA Processing
Once about 20-40 ribonucleotides have been joined together by RNA polymerase, a group of enzymes adds a “cap” to the 5’ end of the growing transcript. In this process, a 5’ phosphate is replaced by modified guanosine that has a methyl group attached to it (7-Methyl guanosine). This 5’ cap helps the...
RNA Splicing
RNA Splicing
RACE - Rapid Amplification of cDNA Ends
Since the...

