Jove
Visualize
Contact Us
JoVE
x logofacebook logolinkedin logoyoutube logo
ABOUT JoVE
OverviewLeadershipBlogJoVE Help Center
AUTHORS
Publishing ProcessEditorial BoardScope & PoliciesPeer ReviewFAQSubmit
LIBRARIANS
TestimonialsSubscriptionsAccessResourcesLibrary Advisory BoardFAQ
RESEARCH
JoVE JournalMethods CollectionsJoVE Encyclopedia of ExperimentsArchive
EDUCATION
JoVE CoreJoVE BusinessJoVE Science EducationJoVE Lab ManualFaculty Resource CenterFaculty Site
Terms & Conditions of Use
Privacy Policy
Policies

Related Concept Videos

Viruses of Archaea01:29

Viruses of Archaea

Archaeal viruses play a crucial role in the ecosystems of extremophilic archaea, particularly those belonging to the phyla Euryarchaeota and Crenarchaeota. By shaping host evolution and facilitating gene transfer, these viruses influence microbial communities and contribute to genetic diversity in extreme environments. The archaea they infect thrive in acidic hot springs and hydrothermal vents characterized by high temperatures and low pH. Archaeal viruses exhibit remarkable structural...
The Antiviral System of Bacteria and Archaea: CRISPR01:23

The Antiviral System of Bacteria and Archaea: CRISPR

CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats is a adaptive immune system found in bacteria and archaea that protects against viral infections. This system enables prokaryotic cells to identify, remember, and neutralize foreign genetic elements, primarily bacteriophages, by storing fragments of the invader’s DNA as a genetic memory.The CRISPR immune response begins during an initial infection. Cas (CRISPR-associated) proteins play a central role in this defense.
Plasmids01:28

Plasmids

Plasmids are extrachromosomal DNA molecules found in bacteria, archaea, and some eukaryotic microbes like yeast. These small, circular DNA structures typically contain fewer than 30 genes, although some may exist linearly. Plasmids vary in their number within a cell, known as copy number. Single-copy plasmids are present in one copy per cell and multi-copy plasmids are present in multiple copies, reaching over 100 copies per cell.Plasmids usually replicate independently of the chromosomal DNA...
Diversity of Archaea III01:27

Diversity of Archaea III

Crenarchaeota, a prominent phylum of Archaea, is remarkable for its ability to thrive in extreme environments characterized by high temperatures and acidity. These microorganisms inhabit sulfuric hot springs, volcanic systems, and submarine hydrothermal vents, where temperatures often exceed 100°C. The unique adaptations of Crenarchaeota not only allow survival under such extreme conditions but also provide insights into the mechanisms of life in primordial Earth-like environments.Morphological...
CRISPR and crRNAs02:53

CRISPR and crRNAs

Bacteria and archaea are susceptible to viral infections just like eukaryotes; therefore, they have developed a unique adaptive immune system to protect themselves. Clustered regularly interspaced short palindromic repeats and CRISPR-associated proteins (CRISPR-Cas) are present in more than 45% of known bacteria and 90% of known archaea.
The CRISPR-Cas system stores a copy of foreign DNA in the host genome and uses it to identify the foreign DNA upon reinfection. CRISPR-Cas has three different...
Viral Recombination00:57

Viral Recombination

Cells are sometimes infected by more than one virus at once. When two viruses disassemble to expose their genomes for replication in the same cell, similar regions of their genomes can pair together and exchange sequences in a process called recombination. Alternatively, viruses with segmented genomes can swap segments in a process called reassortment.

You might also read

Related Articles

Articles linked to this work by shared authors, journal, and citation graph.

Sort by
Same author

Design and Synthesis of Insensitive Fused Triazolo-Pyrimidine-Based Energetic Materials.

Organic letters·2026
Same author

Extensive Evaluation of Dinitropyrazole and Tetrazole-Based Energetic Compounds: Role of Isomerism and Oxygen Balance on the Overall Performance.

The Journal of organic chemistry·2025
Same author

Tailored Nanoparticle Organic Network Membranes for Hydrogen Generation.

Small (Weinheim an der Bergstrasse, Germany)·2025
Same author

Alzheimer's disease rewires gene coexpression networks coupling different brain regions.

NPJ systems biology and applications·2024
Same author

MultiCens: Multilayer network centrality measures to uncover molecular mediators of tissue-tissue communication.

PLoS computational biology·2023
Same author

The pattern of coding sequences in the chloroplast genome of Atropa belladonna and a comparative analysis with other related genomes in the nightshade family.

Genomics & informatics·2023
Same journal

Anti-mycobacterial activity of phytocompounds from <i>Ricinus communis</i> L. - an integrated <i>in-vitro</i> and <i>in-silico</i> approach.

Journal of biomolecular structure & dynamics·2026
Same journal

Binding studies of the X-ray characterized [SnMe<sub>2</sub>Cl<sub>2</sub>(Me<sub>2</sub>phen)] complex with human serum albumin: experimental and molecular docking approaches.

Journal of biomolecular structure & dynamics·2026
Same journal

Computational design and experimental validation of peptide inhibitors to disrupt urease enzyme maturation in pathogenic bacteria <i>Proteus mirabilis</i>.

Journal of biomolecular structure & dynamics·2026
Same journal

Wavelet-domain multiway spectral separation of free drug, DNA, and drug-DNA complex profiles for quantitative binding analysis based on fractional occupancy (<i>θ</i>).

Journal of biomolecular structure & dynamics·2026
Same journal

Gene expression and microsecond scale conformational dynamics suggest potential regulatory mechanisms for the expanded subtilase family of <i>T. rubrum</i>.

Journal of biomolecular structure & dynamics·2026
Same journal

Deciphering the Role of Sugar Osmolytes in Free and Nano forms to Mitigate Protein Aggregation: Insights from Biophysical and Microscopic Studies.

Journal of biomolecular structure & dynamics·2026
See all related articles

Related Experiment Video

Updated: May 11, 2026

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion
07:37

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion

Published on: June 25, 2017

Viral/plasmid captures in Crenarchaea.

Smarajit Das1, Sanga Mitra, Satyabrata Sahoo

  • 1a Department of Medical Biochemistry and Cell Biology, Institute for Biomedicine , University of Gothenburg , Göteborg , 40530 , Sweden .

Journal of Biomolecular Structure & Dynamics
|May 11, 2013
PubMed
Summary
This summary is machine-generated.

Viral integration into host chromosomes leaves behind retrenched tRNAs (rtRNAs). These rtRNAs in Crenarchaea are nonrandomly fragmented, often near the golden ratio, suggesting new viral entities.

More Related Videos

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses
12:20

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Published on: December 29, 2015

Transgene Expression in Cultured Cells Using Unpurified Recombinant Adeno-Associated Viral Vectors
06:41

Transgene Expression in Cultured Cells Using Unpurified Recombinant Adeno-Associated Viral Vectors

Published on: October 20, 2023

Related Experiment Videos

Last Updated: May 11, 2026

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion
07:37

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion

Published on: June 25, 2017

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses
12:20

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses

Published on: December 29, 2015

Transgene Expression in Cultured Cells Using Unpurified Recombinant Adeno-Associated Viral Vectors
06:41

Transgene Expression in Cultured Cells Using Unpurified Recombinant Adeno-Associated Viral Vectors

Published on: October 20, 2023

Area of Science:

  • Microbiology
  • Virology
  • Genetics

Background:

  • Viral and plasmid genomes integrate into host chromosomes via homologous recombination, catalyzed by integrases.
  • This integration process leaves a characteristic 3'-fractional tRNA motif, termed retrenched tRNA (rtRNA), on the host chromosome.

Purpose of the Study:

  • To identify and characterize host rtRNAs in Crenarchaea.
  • To investigate conserved features within viral/plasmid tRNA motifs and integrases associated with integration.
  • To determine the fragmentation pattern of tRNA during integration in Crenarchaea.

Main Methods:

  • Identification of host rtRNAs and conserved viral/plasmid tRNA motifs and integrase features in Crenarchaea.
  • Analysis of the nucleotide sequence and length of viral integrase N-terminal motif (GTATTATGTTTACTCAATAGAGAA).
  • Examination of upstream viral tRNA motifs for conserved poly-cytosine regions and hairpin secondary structures.

Main Results:

  • Conserved features in viral integrases and tRNA motifs were identified in Crenarchaea.
  • Up to two rtRNAs were observed on crenarchaeal chromosomes, corresponding to host tRNAs.
  • rtRNA lengths were nonrandom, with fragmentation fractions of 61.8%, 50%, 38.2%, or 23.6%, approximating ratios of 3:2, 1:1, 2:3, or 1:3.
  • Over 79% of rtRNAs exhibited lengths corresponding to a 38.2% excision, resulting in a tRNA to rtRNA length ratio near the golden ratio (1.618).

Conclusions:

  • Viral integration in Crenarchaea results in rtRNAs with lengths significantly associated with the golden ratio.
  • The nonrandom fragmentation of tRNA during integration provides insights into viral-host interactions.
  • Evidence suggests the existence of novel extremophile viral entities within Crenarchaea.