Related Experiment Video
Updated: May 11, 2026

CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion
Published on: June 25, 2017
Viral/plasmid captures in Crenarchaea
Smarajit Das1, Sanga Mitra, Satyabrata Sahoo
1a Department of Medical Biochemistry and Cell Biology, Institute for Biomedicine , University of Gothenburg , Göteborg , 40530 , Sweden .
Abstract:
tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3'-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3'-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.
Related Concept Videos
Viruses of Archaea
The Antiviral System of Bacteria and Archaea: CRISPR
Plasmids
Diversity of Archaea III
CRISPR and crRNAs
The CRISPR-Cas system stores a copy of foreign DNA in the host genome and uses it to identify the foreign DNA upon reinfection. CRISPR-Cas has three different...
Viral Recombination

