Related Experiment Video
Updated: May 8, 2026

mirMachine: A One-Stop Shop for Plant miRNA Annotation
Published on: May 1, 2021
miR156- and miR171-binding sites in the protein-coding sequences of several plant genes
Assyl Bari1, Saltanat Orazova, Anatoliy Ivashchenko
1Al-Farabi Kazakh National University, Almaty 050038, Kazakhstan.
Abstract:
We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a-j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a-d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a-c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a-c families should be in one family.
Insights
MicroRNAs (miRNAs) targeting SPL and HAM genes in Arabidopsis thaliana show conserved binding sites and encoded peptides across species. This suggests merging miR156/miR157 and miR170/miR171 families due to conserved functions.
Area of Science:
- Plant molecular biology
- Genetics and genomics
- Bioinformatics
Background:
- MicroRNAs (miRNAs) are key regulators of gene expression in plants.
- SPL and HAM genes are important in plant development.
- Understanding miRNA-mRNA interactions is crucial for deciphering gene regulatory networks.
Purpose of the Study:
- To identify and characterize miRNA binding sites in SPL and HAM gene homologs across different plant species.
- To investigate the conservation of these binding sites and the encoded amino acid motifs.
- To propose potential reclassifications of miRNA families based on conserved interactions.
Main Methods:
- Bioinformatic analysis of miRNA binding sites in mRNA sequences of SPL and HAM genes.
- Sequence alignment and homology searches across multiple plant species.
- Identification of conserved nucleotide sequences and encoded peptide motifs.
Main Results:
- Conserved binding sites for miR156/miR157 were found in SPL gene mRNAs, encoding the ALSLLS motif.
- Conserved binding sites for miR170/miR171 were identified in HAM gene mRNAs, encoding the ILARLN motif.
- These binding sites and encoded motifs are conserved in orthologs across numerous plant species.
Conclusions:
- The miR156 and miR157 families likely share conserved functions and could be merged.
- The miR170 and miR171 families also exhibit conserved interactions and potential for merging.
- Conserved miRNA-mRNA interactions highlight fundamental regulatory mechanisms in plant gene expression.
Related Concept Videos
Cell Signaling in Plants
Cis-regulatory Sequences
Conserved Binding Sites
Binding sites are often located in large pockets, and if their location on a protein’s surface is unknown, it can be predicted using various approaches. The energetic method computationally analyses the...

