Related Experiment Video
Updated: Mar 20, 2026

Bacterial Artificial Chromosomes: A Functional Genomics Tool for the Study of Positive-strand RNA Viruses
Published on: December 29, 2015
Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern
Wenqiang Zhang1,2, Xiaojuan Lin1,2, Ping Jiang3
1Academy of Preventive Medicine, Shandong University, Jinan, People's Republic of China.
Abstract:
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
Insights
Coxsackievirus B3 (CV-B3) strains in China show genetic recombination and mutation, contributing to aseptic meningitis. Further surveillance is crucial due to co-circulation in mainland China and Hong Kong.
Area of Science:
- Virology
- Molecular Biology
- Epidemiology
Background:
- Coxsackievirus B3 (CV-B3) is a significant cause of aseptic meningitis outbreaks.
- Previous studies have linked CV-B3 to neurological diseases, but specific genetic drivers remain under investigation.
- Understanding viral genetic diversity is key to controlling outbreaks and predicting disease severity.
Purpose of the Study:
- To identify sequence motifs associated with aseptic meningitis caused by CV-B3.
- To construct an infectious clone of a representative CV-B3 strain.
- To analyze the genetic relatedness and evolutionary patterns of CV-B3 strains in China.
Main Methods:
- Whole genome sequencing of the 08TC170 CV-B3 strain isolated from cerebrospinal fluid.
- Sequence alignment and phylogenetic analysis of coding regions (P1-P3, VP1).
- Similarity plot analysis to identify potential recombination events.
- Mutation analysis, specifically focusing on the T277A substitution.
Main Results:
- The 08TC170 strain shares high sequence identity (≥97.7%) with other Chinese CV-B3 strains, forming a distinct cluster.
- Evidence of intertypic recombination was found, with similarity to CV-B5 or E-6 strains in specific genomic regions.
- A novel T277A mutation was identified in strains from 2008-2010, distinguishing them from earlier isolates.
Conclusions:
- The 08TC170 CV-B3 strain likely resulted from both intertypic recombination and point mutation.
- The identified genetic features suggest co-circulation of related CV-B3 strains in mainland China and Hong Kong.
- Ongoing molecular surveillance is recommended to monitor CV-B3 evolution and potential neurovirulence.
More Related Videos
18:10Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency
Published on: June 16, 2011
09:13Using Reverse Genetics to Manipulate the NSs Gene of the Rift Valley Fever Virus MP-12 Strain to Improve Vaccine Safety and Efficacy
Published on: November 1, 2011
Related Concept Videos
Viral Meningitis
Viral Recombination
Bacterial Gastroenteritis