Related Experiment Video
Updated: Aug 25, 2026

Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism
Published on: December 18, 2013
N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution
1National Institute for Medical Research, London, U.K.
Abstract:
A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.
Related Concept Videos
Transcription Attenuation in Prokaryotes
There are several different mechanisms used to attenuate transcription. In ribosome mediated...
¹H NMR of Conformationally Flexible Molecules: Temporal Resolution
¹H NMR of Conformationally Flexible Molecules: Variable-Temperature NMR
Bacterial Protein Maturation
Repressible Operon: trp Operon

