Related Experiment Video
Updated: Mar 12, 2026

Detection of Rare Genomic Variants from Pooled Sequencing Using SPLINTER
Published on: June 23, 2012
SLC22A2 - mapping genomic variations within South African indigenous and admixed populations
Background:
The SLC22A2 gene is a polyspecific transporter that mediates the electrogenic transport of small organic cations with different molecular structures. Furthermore, single-nucleotide polymorphisms (SNPs) of SLC22A2 are clinically significant because they can alter the transport of substrate drugs and may, thus, influence the efficacy and toxicity thereof. Additionally, further studies have reported that SLC22A2 is responsible for 80% of the total metformin clearance. Therefore, loss-of-function variants of SLC22A2 could affect the pharmacokinetic and pharmacodynamic characteristics of metformin. Although it is widely accepted that African populations harbor a greater amount of genomic diversity compared to other populations, limited information is available regarding genetic polymorphisms in SLC genes among African populations, specifically those related to impaired functional activity of hOCT2. Therefore, the aim of this study was to map known impaired function variants in the SLC22A2 gene.
Methods:
Development of multiplex SNaPshot™ genotyping assay for 20 previously reported SLC22A2 nonsynonymous SNPs and the assessment of baseline allele frequencies of these variants in 140 Cape Admixed, 148 Xhosa and 152 Zulu individuals residing in Cape Town, South Africa.
Results:
We identified three nonsynonymous SNPs, namely, A270S, R400C and K432Q in the population studied at minor allele frequencies of 6.1%, 3.4% and 0.7%, respectively. The most frequently observed haplotypes across all three populations were CATAATGCGTACGCGCGACG (~85%), CATAATGATTACGCGCGACG (~7%) and CATAATGAGTACGCGCGACG (~4.5%).
Conclusions:
In addition to SNPs, the haplotypes identified in this study can in future also aid in identifying associations between causative genetic variants and drug response. This study contributes in filling the gap that exists with regards to genetic information about important variations in organic cation transporter genes for the indigenous populations of South Africa.
More Related Videos
04:41Mapping Alzheimer's Disease Variants to Their Target Genes Using Computational Analysis of Chromatin Configuration
Published on: January 9, 2020
09:34Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease
Published on: April 4, 2018
Related Concept Videos
Comparing Copy Number Variations and SNPs
Copy number variations or CNVs are the structural variations that cover more than 1kb of DNA sequence. The single nucleotide polymorphism (SNP), on the other hand, is a single nucleotide change or a point mutation that is found in more than 1%...
Single Nucleotide Polymorphisms-SNPs
Genetic Variation
Genes exist in different versions called alleles,...
Principles of Pharmacogenetics: Types of Genetic Variants
Genome-wide Association Studies-GWAS
GWAS does not require the identification of the target gene involved in...
Pharmacogenetics of Drug Transporters: P-Glycoprotein and Solute Carrier Transporters