Related Experiment Video
Updated: Feb 21, 2026
Author Spotlight: Finding New Therapeutic Targets for Malignant Peripheral Nerve Sheath Tumor Through Genome-Scale shRNA Screens
Published on: August 25, 2023
[Analysis of NF2 gene mutations in intraspinal Schwannomas]
Shuyi Liu1, Shi Chen, Kaichuang Zhang
1Department of Neurosurgery, Fuzhou Second Hospital, Xiamen University, Fuzhou, Fujian 350007, China. shengzeliu@163.com.
Objective:
To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
Methods:
Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
Results:
Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
Conclusion:
The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
