Related Experiment Videos
Complete nucleotide sequence of the low copy number plasmid pRAT11 and replication control by the RepA protein in
Abstract:
The 2.6 kb kanamycin-resistant (Kmr) plasmid, pRAT11, was constructed using both the replication determinant (repA) region of the 10.8 kb tetracycline-resistant (Tcr) low copy number plasmid pTB52 and another fragment (0.9 kb) that contained solely the Kmr gene of pUB110. The complete nucleotide sequence of this plasmid was determined. The repA region contained a large open reading frame encoding RepA protein (396 amino acid residues). In vitro transcription and translation of the repA gene were confirmed. RepA protein was shown to be indispensable for plasmid replication, and acted in trans on DNA. The part of the repA gene encoding the specific recognition region of the RepA protein was located and contained 3.5 direct repeats of 24 bp (GGTTTCAAAAATGAAACGGTGGAG). Upstream and downstream of the direct repeats were the recognition sequence (TTATCCACA) of the Escherichia coli DnaA protein and an AT-rich region, respectively. The replication control mechanism of the low copy number Bacillus plasmid is discussed.