Related Experiment Video
Updated: Feb 3, 2026

Substrate Generation for Endonucleases of CRISPR/Cas Systems
Published on: September 8, 2012
Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria
Chen Dong1, Jason Fontana2, Anika Patel1
1Department of Chemistry, University of Washington, Seattle, WA, 98195, USA.
Abstract:
In the original version of the Supplementary Information file associated with this Article, the sequence '1x MS2 scRNA.b2' was incorrectly given as 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT' and should have read 'GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT'. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.
Related Concept Videos
CRISPR and crRNAs
The CRISPR-Cas system stores a copy of foreign DNA in the host genome and uses it to identify the foreign DNA upon reinfection. CRISPR-Cas has three different...
Prokaryotic Transcriptional Activators and Repressors
Transcription of prokaryotic...
CRISPR
Eukaryotic Transcription Activators
The binding domains are capable of recognizing and interacting with regulatory sequences on the DNA. These...
Milgram's Obedience to Authority
The Antiviral System of Bacteria and Archaea: CRISPR

