Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure

Area of Science:

• Molecular Biology
• Biophysics
• Genetics

Background:

• Deregulation of the c-KIT proto-oncogene is linked to various cancers.
• The c-KIT promoter contains G-rich regions (kit1, kit*, kit2) capable of forming G-quadruplexes.
• The kit* region's folding behavior and regulatory role in c-KIT transcription are poorly understood.

Purpose of the Study:

• To investigate the G-quadruplex folding behavior of the kit* region.
• To elucidate the structural characteristics and stability of the kit* G-quadruplex.
• To explore the potential role of kit* G-quadruplex formation in regulating c-KIT gene expression.

Main Methods:

• Spectroscopic techniques
• Biophysical methods
• G-quadruplex structure analysis

Main Results:

• The kit* sequence (d[GGCGAGGAGGGGCGTGGCCGGC]) forms a chair-type antiparallel G-quadruplex with two G-quartets in the presence of KCl.
• Ion-dependent structural heterogeneity was observed, with Na+ and NH4+ stabilizing pre-folded structures.
• Stability is enhanced by adenine-thymine stacking, a G10•C18 base pair, and a 3'-terminal fold-back motif, facilitating bimolecular folding.
• The kinetics of kit* G-quadruplex formation align with transcriptional process timescales.

Conclusions:

• The kit* G-rich region adopts a stable G-quadruplex structure influenced by ion type and sequence elements.
• The 3'-tail plays a crucial role in promoting bimolecular folding into a single G-quadruplex.
• The folding kinetics suggest a potential interplay between kinetic and thermodynamic factors in regulating c-KIT proto-oncogene expression.