Related Experiment Video
Updated: Jan 30, 2026

Migration, Chemo-Attraction, and Co-Culture Assays for Human Stem Cell-Derived Endothelial Cells and GABAergic Neurons
Published on: January 23, 2020
Glucose affects cell viability, migration, angiogenesis and cellular adhesion of human retinal capillary endothelial
Yang Fu1,2, Min Tang1,2, Xiaoqiong Xiang3
1Department of Ophthalmology, Shanghai General Hospital of Nanjing Medical University, Shanghai 200080, P.R. China.
Abstract:
The expression of secreted protein acidic and rich in cysteine (SPARC) has been recently identified to be associated with the pathology of diabetic retinopathy. Therefore, the present study aimed to evaluate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs), following exposure to a high glucose environment in vitro. The cell viability, migration, angiogenesis, permeability and SPARC expression levels of HRCECs were measured following treatment with different concentrations of glucose (25, 50 or 100 mM). Lentiviral vectors (LV185-pL_shRNA_mKate2-SPARC-543; target sequence, GGATGAGGACAACAACCTTCT) that inhibit the expression of SPARC were constructed, and HRCECs were evaluated when infected by viruses carrying the lentiviral vectors. Cell viability was examined using the Cell Counting Kit-8 assay. The expression of SPARC in HRCECs increased as the concentration of glucose in the culture medium increased. Relatively high concentrations of glucose significantly inhibited cell proliferation (P<0.05), migration (P<0.05), angiogenesis (P<0.01), and the expression of ZO, occludin, claudin and JAM1 in tight junctions (P<0.01), gap junctions (Cx37 and Cx43; P<0.01) and adherens junctions (VE-cadherin, CTNNA1 and CTNNB1; P<0.05). However, when SPARC was downregulated by lentiviral vectors, the inhibitions induced by high concentrations of glucose were partially reversed. To conclude, the inhibitory effects on cell viability, migration, angiogenesis and cellular adhesion of HRCECs induced by high concentrations of glucose were reversed once the expression of SPARC was inhibited. These findings suggest that SPARC may serve an important role in pathogenesis of diabetic retinopathy.
Insights
Secreted protein acidic and rich in cysteine (SPARC) exacerbates diabetic retinopathy by impairing human retinal capillary endothelial cells. Inhibiting SPARC expression partially reversed high glucose-induced damage, suggesting SPARC
Area of Science:
- Ophthalmology
- Endocrinology
- Molecular Biology
Background:
- Diabetic retinopathy (DR) is a significant complication of diabetes mellitus.
- Secreted protein acidic and rich in cysteine (SPARC) expression is linked to DR pathology.
- The precise role of SPARC in retinal endothelial cells under hyperglycemic conditions requires elucidation.
Purpose of the Study:
- To investigate the regulatory role of SPARC in human retinal capillary endothelial cells (HRCECs).
- To assess the impact of high glucose on HRCECs and the involvement of SPARC.
- To evaluate the therapeutic potential of SPARC inhibition in a high glucose environment.
Main Methods:
- HRCECs were exposed to varying high glucose concentrations (25, 50, 100 mM).
- SPARC expression was modulated using lentiviral vectors to achieve downregulation.
- Cell viability (CCK-8 assay), migration, angiogenesis, and tight/adherens/gap junction protein expression were analyzed.
Main Results:
- High glucose significantly increased SPARC expression in HRCECs.
- Hyperglycemia inhibited HRCEC proliferation, migration, angiogenesis, and junctional protein expression.
- Downregulation of SPARC partially reversed these detrimental effects induced by high glucose.
Conclusions:
- SPARC plays a crucial role in mediating the adverse effects of high glucose on HRCECs.
- Inhibition of SPARC can ameliorate glucose-induced damage to retinal endothelial cells.
- SPARC represents a potential therapeutic target for managing diabetic retinopathy.
Related Concept Videos
Cell Migration
Cell Migration
Cell Adhesion in Plants
Pectins are complex heteropolymers mainly composed of negatively-charged α-D-glucopyranosyl uronic acid and some neutral glycosyl residues such as α-L-rhamnopyranose, α-L-arabinofuranose,...
Adhesion
Capillary action is a result of water’s adhesive tendencies. When a narrow...
Immunoglobulin-like Cell Adhesion Molecules
Ig-CAMs exhibit either homophilic binding (to other Ig-CAMs) or heterophilic binding (to other ligands such as integrins). While most Ig-CAMs...
Cancer Cell Migration through Invadopodia

