Related Experiment Video
Updated: Jan 30, 2026

Methods of Soil Resampling to Monitor Changes in the Chemical Concentrations of Forest Soils
Published on: November 25, 2016
First Report of Fagus sylvatica Infection by Fusarium avenaceum in Forest Container Nurseries in Northeastern Poland
A Okorski1, A Pszczółkowska1, S Okorska2
1Department of Plant Diagnostics and Pathophysiology.
Abstract:
Container nurseries in northeastern Poland annually provide several million tree seedlings used for afforestation of post-agricultural soils and restocking of forests. Beech (Fagus sylvatica), one of the main forest tree species in Poland, is largely applied in this process. We have observed in container nurseries of young beech saplings in Poland symptoms of wilting and damping off. The average rate of damage in container cultures was 21 to 31%, including those beech seedlings (5 to 7%) that eventually succumbed. The infected leaves, stems, and roots were washed in distilled water and then disinfected with 70% ethanol and 1% sodium hypochlorite. The plates with plant material were incubated at 22°C for approximately 7 days. A total of 14 single-spore fungal cultures isolated from infected beech seedlings were identified, based on morphological features, as F. avenaceum (1,2). PDA colonies consisted of flat, aerial mycelium that was white to rose, with rose to carmine pigment on the reverse surface, with small black sclerotial bodies. Microconidia were cylindrical with one to four septa, predominantly 10 to 25 μm long. Macroconidia were hyaline, straight to slightly curved, four- to six-septate (generally 50 to 65 × 4 to 4.5 μm). All isolates were deposited in the Department of Plant Diagnostics and Pathophysiology Fungal Culture Collection (Accession Nos. FL.Ol.35.13-42.13) (University of Warmia and Mazury in Olsztyn, Poland) and are stored in 15% glycerol at -80°C. DNA from the fungal cultures was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete of EF1α gene sequence was amplified with the primers avef11 (CGACTCTGGCAAGTCGACCA) and avef12 (TACCAATGACGGTGACATAG) and sequenced. A single sequence from isolate FL.Ol.35.13, which was used in the beech infection study (Gen Bank Accession No. KM985475), was obtained. It had the length of 411 bp and was 100% identical to sequences of several isolates of F. avenaceum at GenBank (HQ704072.1, EF512014.1, and HQ704073). To verify pathogenicity of the fungus, a controlled infection was carried out with spores of isolate FL.Ol.35.13. The spores were used at the density of 2 × 105/ml. Seeds of beech were sown to sterile perlite, and after cotyledon emergence they were watered with F. avenaceum spore suspension (5 ml/plant). Control plants were treated with water only. After 30 days, the rate of disease was estimated. Severely infected seedlings showed typical symptoms of damping-off and Fusarium wilt, while in less-affected seedlings, zonated spots with F. avenaceum sporodochia could be seen on cotyledons. No infection symptoms were seen on control seedlings. Fungal cultures were started from plants subjected to controlled infection, and, based on morphological features, the fungus was identified again as F. avenaceum. To our knowledge this is the first report of Fusarium (F. avenaceum) disease of beech in container nurseries in Poland. References: (1) W. Gerlach and H. I. Nirenberg. Mitt. Biol. Bundesanst. Land- Forstwirsch., Berlin-Dahlem 209:1, 1982. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Professional, Ames, IA, 2006.
Related Concept Videos
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders
Reporter Genes
Introduction to Documentation and Reporting
Nursing documentation records essential information and details regarding a patient's care and treatment in written or electronic form. It is a critical aspect of nursing practice that involves documenting assessments, interventions, outcomes, and other relevant details about a patient's health status.
Documentation maps the patient's health journey by creating a comprehensive...

