First Report of Apple chlorotic leaf spot virus in Hawthorn in China

Apple chlorotic leaf spot virus (ACLSV) is the type species of the genus Trichovirus in the Betaflexiviridae family (1). ACLSV is distributed worldwide in most pome and stone fruit trees of the Rosaceae family, including apple, pear, peach, plum, cherry, apricot, and hawthorn (3). In 2012, a de novo assembly of the fruit transcriptome of a hawthorn (Crataegus pinnatifida) accession maintained in the National Hawthorn Germplasm Repository at Shenyang was conducted using Illumina-based RNA-seq data, and it resulted that a 7,543 nt of the genomic sequence of ACLSV was assembled. To confirm the result of Illumina RNA-Seq analysis, nine pairs of primers were designed according to the assembled sequence of ACLSV to amplify the genomic sequence of ACLSV by RT-PCR with total RNA extracted from hawthorn leaves as template (2). The full-length sequence of the isolate of ACLSV from hawthorn assembled with the sequences of the RT-PCR fragments was also 7,543 nt (GenBank Accession No. KM207212), which shows 99.5% nucleotide identity with the sequence assembled from Illumina RNA-seq data. The isolate of ACLSV from hawthorn was named SY01, which shows about 75% nucleotide identity with the sequences of ACLSV isolated from apple (GenBank Accession No. KJ522693), peach (JN634760), and plum (M58152). The nucleotide sequences of coat protein and RNA polymerase genes of SY01 are about 83 and 88% identical with those of ACLSV isolates in GenBank, respectively. A pair of primers HF/HR (ACCGGCGTCTTTTGCAAACT/TGGGTTCCAGAGTTTGAATGCA), which amplified a 210-bp fragment, was designed according to the sequence of SY01 to detect ACLSV in hawthorns. With RT-PCR, ACLSV was detected in 6 of the 30 accessions of hawthorn, and the nucleotide identity among PCR fragments was 92%. In addition, leaves from six RT-PCR positive plants reacted positively when tested by DAS-ELISA with polyclonal antisera (X-Y Biotechnology, Shanghai, China) raised against ACLSV. These findings, representing the first report of the presence of ACLSV in hawthorn in China, illustrate the need to develop virus-free trees of hawthorn for cultivation and germplasm distribution of this important Rosaceae family plant. References: (1) E. B. Carstens. Arch. Virol. 155:133, 2010. (2) H. Dai et al. PLoS ONE 8(9):e72910, 2013. (3) A. T. Katsiani et al. Plant Pathol. 63:63, 2014.