Related Experiment Video
Updated: Jan 30, 2026

High and Low Throughput Screens with Root-knot Nematodes Meloidogyne spp.
Published on: March 12, 2012
First Report of the Stubby-Root Nematode (Paratrichodorus allius) From a Corn Field in Ohio
H D Lopez-Nicora1, T Mekete1, N Sekora2
1Department of Plant Pathology, Ohio State University, Columbus 43210.
Abstract:
Stubby-root nematodes (family Trichoridae) are an economically important group of ectoparasites that feed on roots, vector tobraviruses, and cause substantial crop loss (1,2,3). In June 2013, 48 soil samples were submitted to the Nematology Laboratory at Ohio State University for nematode analysis from a field planted to corn in Wood County, Ohio. The soil texture was sandy and the field was previously planted to wheat and soybean in 2011 and 2012, respectively. Nematodes were extracted from 100 cm3 soil by decanting and sieving followed by sucrose centrifugal flotation. Phytoparasitic nematodes were identified and counted based on morphological traits to genus at 40× to 63× magnification. Nematode genera parasitic to corn recovered from these samples included Helicotylenchus, Hoplolaimus, Paratrichodorus, Pratylenchus, and Tylenchorhynchus. Stubby-root nematodes (Paratrichodorus sp.) were detected in more than 60% of the samples with a maximum count of 52 per 100 cm3 soil. Individual stubby-root nematodes were hand-picked and identified to species under a compound light microscope as Paratrichodorus allius (Jensen, 1963) Siddiqi, 1974 according to morphological and morphometric characteristics (1). Females (n = 14) were observed with the intestine not anteriorly overlapping the esophagus, posterior subventral esophageal glands overlapping the intestine, caudal pores, absence of spermatheca, and vaginal sclerotization reduced in lateral view. Body length ranged from 475.8 to 840.5 μm (mean = 652.2 μm), and onchiostylet length ranged from 37.7 to 47.4 μm (mean = 42.9 μm). DNA was extracted from single adult females (n = 4) and the 18S rRNA region was amplified with 18S (TTGATTACGTCCCTGCCCTTT) and 26S (TTTCACTCGCCGTTACTAAGG) primers (4). PCR products were purified and sequenced. The sequence was deposited in GenBank (Accession No. KF887974) and was compared with previously deposited sequences by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with both P. allius and P. teres (AM269895, AM087124, AJ439572, FJ040484, AJ439575, and AM087125). P. allius and P. teres can be difficult to discriminate using both morphological characteristics and molecular sequencing (3). Therefore, a universal primer (BL18: 5' CCCGTCGMTACTACCGATT 3') and species-specific primers designed to produce PCR products of 432 bp (PAR2: 5'-CCGTTCAAACGCGTATATGATC-3') and 677 bp (PTR4: 5'-CCTGACAAGC'IWGCACTAGC-3') were used for P. allius and P. teres, respectively (3). DNA from individuals used for sequencing was used in PCR reactions with each species-specific primer. DNA samples yielded PCR products of 432 bp with the P. allius-specific primer set and had no reaction with the P. teres-specific primer set. Molecular results and morphological observations confirmed the presence of P. allius in the samples. P. allius is a polyphagous migratory ectoparasite and a vector for Tobacco rattle virus (TRV). The known distribution of P. allius has previously been limited to the Pacific Northwest, where it was originally described as an important pathogen in potato production (2,3). Corn and wheat have been reported as suitable hosts; although they are not susceptible to TRV, crop loss may result from direct damage to roots (2,3). Nematode management recommendations for corn and wheat will depend on the distribution of this nematode. To our knowledge, this is the first report of P. allius in Ohio. References: (1) W. Decreamer. Rev. Nematol. 3:81, 1980. (2) H. Mojtahedi and G. S. Santo. Am. J. Potato Res. 76:273, 1999. (3) E. Riga et al. Am. J. Potato Res. 84:2, 2007. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:563, 1992.
More Related Videos
10:35In vivo and In vitro Infection of Potato Roots with Plant Parasitic Nematodes for the Assessment of Induced Structural Changes
Published on: February 28, 2025
13:00Modifying the Bank Erosion Hazard Index BEHI Protocol for Rapid Assessment of Streambank Erosion in Northeastern Ohio
Published on: February 13, 2015
Related Concept Videos
Primary and Secondary Growth in Roots and Shoots
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Root Mean Square
For example, consider the velocity of gas molecules in a container. The gas molecules are moving in different directions, which might impart positive and negative...
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders