Related Experiment Video
Updated: Jan 29, 2026

Virus-induced Gene Silencing VIGS in Nicotiana benthamiana and Tomato
Published on: June 10, 2009
First Report of Tomato yellow leaf curl virus in Acalypha australis in China
1Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, P. R. China.
Abstract:
Whitefly-transmitted geminiviruses (WTGs) can cause serious damage to many crops in China, so an investigation of weed hosts of WTGs was carried out in Jiangsu Province, China, in 2012. Fifty-seven symptomless samples of Acalypha australis L., a common weed known as Asian copperleaf, were randomly collected from seven tomato fields in Nanjing and Lianyungang, Jiangsu Province, from July to September. Total DNA of each sample was extracted and PCR was performed using degenerate primers PA and PB to amplify a specific region covering the AV2 gene of DNA-A and part of the adjacent intergenic region (1). DNA fragments were successfully amplified from 27 out of 57 samples and PCR amplicons of 16 samples were sequenced. Alignment results showed that the nucleotide sequence identities ranged from 98 to 100% with Tomato yellow leaf curl virus (TYLCV) accessions. The full-length viral circular DNA genome was amplified using primer pair 1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and 1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) which were designed based on the known sequences amplified by PA and PB. The complete genome sequence (GenBank Accession No. JX910534) was 2,781 nucleotides in length and had 99 to 100% sequence identity with TYLCV accessions (GU434142, GU111505). The dot immunobinding assay using monoclonal antibody against TYLCV confirmed the 27 weed samples positive by PCR were infected by TYLCV. These results demonstrated that A. australis is a host of TYLCV that might play an important role in viral epidemics in tomato fields in China. TYLCV-infected A. australis did not show typical symptoms like leaf curl, chlorosis, and stunting and thus appears to be a symptomless host. In our investigation, the infection rate ranged from 14 to 79% depending on the field sampled, suggesting that the weed may be an important reservoir of TYLCV, especially during the non-tomato planting period. To our knowledge, this is the first report of A. australis as a host of TYLCV in China. Reference: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994.
Related Concept Videos
Divergence and Curl
Divergence and Curl of Electric Field
Divergence and Curl of Magnetic Field
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:

