Wheat mosaic virus (WMoV), the Causal Agent of High Plains Disease, is Present in Ohio Wheat Fields

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat. References: (1) S. G. Jensen et al. Plant Dis. 80:1387, 1996. (2) N. Mielke-Ehred and H.-P. Muhlbach. Viruses 4:1515, 2012. (3) J. M. Skare et al. Virology 347:343, 2006. (4) R. Louie et al. J. Virol. Methods 135:214, 2006.