Related Experiment Video
Updated: Jan 29, 2026

An Effective Inoculation Method for Phytophthora capsici on Black Pepper Plants
Published on: September 16, 2022
First Report of Chilli ringspot virus on Chili Pepper in China
J-H Wang1, S-Y Zhang1, D Gong1
1Ministry of Agriculture Key Laboratory for Tropical Crop Biotechnology, Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Science, Haikou, Hainan 571101, P. R. China.
Abstract:
Viral diseases have been a major limiting factor in the production of chili pepper (Capsicum chinense Jacp. cv. Yellow Lantern) in Hainan Province, China. In a 2009 disease survey, we found heavily infected fields of chili pepper exhibiting typical viral disease symptoms in three counties in Hainan. Total RNA was extracted from leaves of 14 randomly sampled plants and used as templates for reverse transcription (RT)-PCR using a pair of primers (forward 5' CGTAGACAACACACTCATGGT 3', reverse 5' GTTTTCCCAGTCACGAC(T)16 3') that were originally designed to detect Chilli veinal mottle virus (ChiVMV) (2). PCR fragments of 1.6 kb were amplified from the diseased but not the symptom-free samples and were subsequently sequenced. While most samples were found to be infected with ChiVMV, sequences of PCR fragments from three samples showed identities greater than 90% to two sequences of Chilli ringspot virus (ChiRSV), a member of Potyviridae, available in GenBank (Accession Nos. DQ925439 and DQ925438) (1), but less than 60% to that of the Hainan isolate of ChiVMV (Accession No. GQ981316), a distinct potyvirus (2). Furthermore, two of the samples contained one ChiRSV genotype while the third sample contained a different ChiRSV genotype, with a sequence identity of 91.7% between the two. Using these sequences, we subsequently designed a pair of primers (forward 5' TGGGATAGAGCATCTGAGC 3' and reverse 5' GAGTCATTTAGGTCATAATCAGTTT 3') for specific amplification of ChiRSV but not ChiVMV by RT-PCR. A ChiRSV-specific 0.6-kb DNA fragment was amplified from 8 of the 14 samples. Sequencing of these amplicons confirmed the presence of ChiRSV in these samples. Flexuous, rod-shaped virus particles, typical of the potyviruses, were observed by electron microscopy in the virion preparations purified from chili plants infected only with ChiRSV. Virion protein was purified and subjected to analysis by the MALDI-TOF/TOF tandem mass spectrometer (BGI, Shenzhen, China), yielding 35 peptide fragments that share the highest sequence homology to the coat protein of Vietnamese ChiRSV C8 and C9 isolates (GenBank Accession Nos. ABL09413 and ABL09414) (1) with protein sequence coverage of 61.8% and 52.9%, respectively. On the basis of these data, we concluded that the chili plants in Hainan were infected with ChiRSV. This virus was first reported in Vietnam in 2008 (1) but has not been found elsewhere. Leaves of the chili plants infected only with the Hainan isolate of ChiRSV displayed green banding along the main and major lateral veins, light interveinal chlorosis, and crinkling, similar to the symptoms of ChiVMV previously reported in Hainan (2). However, ChiVMV-infected leaves were notably more distorted than those infected by ChiRSV. We did not observe the characteristic ringspots described on ChiRSV-infected chili peppers in Vietnam (1). The difference in the symptoms may be accounted for by different ChiRSV genotypes, chili varieties, or a combination of both. The finding of two distinct viruses causing similar symptoms will help to improve identification and management of viral diseases on chili peppers. References: (1) C. Ha et al. Arch. Virol. 153:45, 2008. (2) J. Wang et al. Plant Dis. 90:377, 2006.
Related Concept Videos
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders
Reporter Genes

