Related Experiment Video
Updated: Jan 29, 2026

Generating Homo- and Heterografts Between Watermelon and Bottle Gourd for the Study of Cold-responsive MicroRNAs
Published on: November 20, 2018
First Report of Watermelon chlorotic stunt virus in Cucurbits in Lebanon
J Samsatly1, H Sobh1, M Jawhari1
1Department of Agricultural Sciences, Faculty of Agricultural and Food Sciences, American University of Beirut, P.O. Box 11-0236, Beirut, Lebanon.
Abstract:
In August 2009 in the Marjyoun region in South Lebanon, severe yellowing symptoms on melon (Cucumis melo) and pronounced dwarfing and mosaics on watermelon (Citrullus lanatus) led to significant yield losses. Watermelon chlorotic stunt virus (WmCSV), genus Begomovirus, family Geminiviridae, was suspected. Symptomatic samples were collected close to the end of the growing season from several fields. The small scale CTAB protocol was followed for nucleic acid extraction. Samples were tested by PCR for WmCSV and Squash leaf curl virus (SLCV) using specific primers for SLCV (2) and newly designed WmCSV specific primers: (WMAR1: 5' TTTTCCGACACGATGAGTGAT 3'; WMAF3: 5' ACTGGACTTAGCGCTTTGTAT 3'; amplicon size 1,061 bp). Of 39 symptomatic samples, 90% were infected with WmCSV, 13/14 (93%) melon samples and 22/25 (88%) watermelon samples, while 64% were infected with SLCV, indicating a high incidence of mixed infections. In November 2009, no cucurbits were found in Marjyoun since farmers refrained from planting late crops after devastating losses in the previous year. Therefore, 92 samples were collected from other southern regions and 114 samples from northern regions. All squash samples had leaf curl symptoms, while 75 to 85% of cucumber and melon had yellowing symptoms. No WmCSV was detected in North Lebanon, even though 100% of squash samples and 79% of other cucurbit samples were positive for SLCV. However, in South Lebanon, WmCSV was detected 9/20 (45%) in melon, 12/32 (38%) in cucumber (Cucumis sativus), and 6/40 (15%) in squash; while the incidence of SLCV was high particularly on squash (39/40, 98%) and cucumber (30/32, 94%) followed by melon (7/20, 35%). The survey was repeated in 2010, and the previous year's results were confirmed: no WmCSV was detected in North Lebanon, while 39/40 (98%) melon samples tested in November were positive for SLCV. In southern Lebanon, WmCSV was not detected in melon or watermelon samples collected in June; however, in November it was detected in 11/23 (48%) squash and 9/33 (27%) melon. WmCSV genome was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare) The RCA product was sequenced using mostly locally designed primers, and the sequences were submitted to GenBank: WmCSV DNA A: HM368371.1; WmCSV DNA B: HM368372. Phylogenetic analysis showed that WmCSV DNA A was most closely related to isolates from Israel (EF201809.1) and Jordan (EU561237.1), sharing 99% nt identities with both isolates; WmCSV DNA B was found to be most closely related to an isolate from Israel (EF201810.1), with 98% nt identity. WmCSV was first detected in Yemen (4) but was detected quite recently in Israel and Jordan (1). Within a short period, Lebanon experienced the introduction of two new whitefly transmitted begomoviruses. WmCSV seems so far to be restricted only to South Lebanon, while SLCV is widespread. The synergistic interaction between a mixed infection by SLCV and WmCSV in melon resulted in significant symptom enhancement, plant shortening, and up to 54% yield reduction in summer (3). Hence, the development of resistant varieties coupled with the implementation of adapted integrated pest management strategies would be essential for successful production of cucurbit crops. References: (1) Al-Musa et al. J. Phytopathol. 156:311, 2008. (2) Sobh et al. Plant Dis. 26:1231, 2012. (3) Sufrin-Ringwald and Lapidot. Phytopathology 101:281, 2011. (4) Walkey et al. Tropical Pest Management 36:195, 1990.
Related Concept Videos
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders
Reporter Genes

