Related Experiment Video
Updated: Jan 29, 2026

Detecting Virus and Salivary Proteins of a Leafhopper Vector in the Plant Host
Published on: September 14, 2021
First Report of Rice stripe virus of Proso Millet in Korea
1Functional Crop Resource Development Division, NICS, RDA, Miryang, 627-803, Korea.
Abstract:
Rice stripe virus (RSV; genus Tenuivirus) is a serious threat to rice production in Korea (2). In 1965, a disease outbreak was observed on rice in South Korea, with plants showing yellow stripe symptoms (2). Reoccurrence of RSV in rice was observed again in 1980 in Gyeonggi and Chungcheong. In 2001, RSV was estimated to be infecting approximately 4,663 ha of rice in the provinces of Gyeonggi and Gangwha and approximately 5,000 ha of riceland in the provinces of Buan and, Seocheon (3). Proso millet (Panicum miliaceum L.) is grown as a cereal grain crop and used mainly for human food in South Korea (1). In June 2009, proso millet plants that displayed yellow stripe symptoms were collected at Sinjeon-Myeon, Gangjin-Gun, and Jeollanam-do provinces, where an outbreak of RSV in rice was reported. Diseased plants tested positive to RSV with an ELISA Kit (KisanBio, Seoul, Korea). Total RNA was extracted from leaf tissue with an RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). RSV coat protein specific-primers were produced (5' TGTGGAACATAGTCCCACAGTAAGT 3'(upstream), 5' CTAAGCCGCAACCATTCCTCCAGT 3'(downstream). Reverse transcription-PCR confirmed the presence of a 494-bp product as predicted for the presence of RSV. The coat protein of RSV isolates collected from proso millet, rice, and foxtail millet in the same area was also sequenced. Results confirmed that phylogenetic relationships were of high homology: 98.9% between RSV isolates from rice and foxtail millet, 99.2% between isolates from rice (GenBank Accession No. JN245626) and proso millet (GenBank Accession No. JN245627); 99.6% between rice and foxtail millet (GenBank Accession No. JN245628); and 99.6% between foxtail millet and proso millet. In addition, sequence comparisons showed 96 to 99% identity with known RSV sequences available in GenBank (Accession No. X53563) (4). To our knowledge, this is the first report of RSV of proso millet in South Korea. The finding of this disease confirms further spread of the virus within the northern part of South Korea and the need for research to develop more effective management options to reduce the impact of RSV in proso millet. References: (1) Y. Y. Choi et al. Biosci. Biotechnol. Biochem. 69:31, 2005. (2) B. C. Lee et al. Res. Plant Dis. 10:30, 2004. (3) B. C. Lee et al. Res. Plant Dis. 14:210, 2008. (4) Y. Zhu. J. Gen. Virol. 72:763, 1991.
Related Concept Videos
What are Viruses?
Data Reporting and Recording
Types of Reports I: Hands-off Report
Following are the key components and categories of hand-off reports:
Purpose and Process:
Types of Reports II: Incident or Occurrence Report
Purposes:
In the healthcare industry, reports play a crucial role in documenting incidents within an agency. The primary objective of these reports is to ensure patient safety, uphold the...
Types of Reports III: Telephone and Verbal Reports
Here's an overview of each type:
Telephone Orders
Reporter Genes

