Related Experiment Video
Updated: Jan 29, 2026

Author Spotlight: Streamlining Rice Breeding with CRISPR/Cas for Obtaining Optimal Phenotypic and Agronomic Traits
Published on: January 3, 2025
A New Leaf Blight of Rice Caused by Pantoea ananatis in India
K K Mondal1, C Mani1, J Singh1
1Division of Plant Pathology, Plant Bacteriology Section, Indian Agricultural Research Institute, New Delhi 110 012, India.
Abstract:
In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 μm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml-1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml-1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.
More Related Videos
05:44Real-Time Detection of Reactive Oxygen Species Production in Immune Response in Rice with a Chemiluminescence Assay
Published on: November 25, 2022
10:14Author Spotlight: Leaf Trait Analysis for Climate and Ecology Reconstruction in Modern and Ancient Plant Communities
Published on: October 25, 2024
Related Concept Videos
Responses to Drought and Flooding
Light as Energy
Photons
A photon is a discrete electromagnetic particle or bundle of energy. Photons are characterized by their frequency, wavelength, and amplitude, similar to the properties of a wave. Waves with higher frequencies transmit more energy and have shorter wavelengths than longer wavelengths that transmit...
Light Acquisition
Plant Breeding and Biotechnology
C4 Pathway and CAM
C4 Pathway
The C4 pathway is used by plants such as...
Anatomy of Chloroplasts