Related Experiment Video
Updated: Jan 28, 2026

Virus-induced Gene Silencing VIGS in Nicotiana benthamiana and Tomato
Published on: June 10, 2009
A New Tomato yellow leaf curl virus Strain in Southern Spain
G Morilla1, C Antúnez1, E R Bejarano1
1Departamento de Genética Universidad de Málaga, 29071 Málaga, Spain.
Abstract:
Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992 when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (Phaseolus vulgaris). In 1999, TYLCV-[ES7297] was found in pepper (Capsicum annuum) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from eight TYLCV single-infected plants (four 'Kampala' and four 'Tiway') were analyzed by polymerase chain reaction using a pair of primers (OTYA7: GCTCCCTGAATGTTCGGATGGA and OTYA8: ATCATGGATTT ACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the eight samples were sequenced and showed 97.9% identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7% identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. References: (1) N. Navot et al. Virology 185(1), 151, 1991. (2) J. Reina et al. Plant Dis. 83:1176, 1999.
Related Concept Videos
Southern Blot
Denatured DNA fragments must be transferred onto a carrier membrane from the gel to make it accessible to a probe - a small ssDNA fragment complementary to the target DNA...
Divergence and Curl
Divergence and Curl of Electric Field
Divergence and Curl of Magnetic Field
What are Viruses?
Thermal Strain

