Related Experiment Video
Updated: Jan 28, 2026

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses
Published on: May 2, 2019
A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of
Y-B Pan1, M P Grisham1, D M Burner1
1USDA-ARS, Southern Regional Research Center, Sugarcane Research Unit, P.O. Box 470, Houma, LA 70361.
Abstract:
A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.
More Related Videos
Related Concept Videos
Translesion DNA Polymerases
TLS polymerases are found in all three domains of life - archaea, bacteria, and eukaryotes. Of the different classes of TLS polymerases, members of the Y family are fitted with specialized structures that...
Bacterial RNA Polymerase
In most genes, the transcription site is a single base present upstream of the coding sequence. Though RNAP is a catalytically efficient enzyme, it does not recognize...
Free-Radical Chain Reaction and Polymerization of Alkenes
Causality in Epidemiology
Eukaryotic RNA Polymerases
All three eukaryotic RNAPs require specific transcription factors, of which the...
RNA Polymerase II Accessory Proteins

