Related Experiment Video
Updated: Jan 22, 2026

Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment
Published on: November 17, 2018
Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome
Angela Jačan1,2, Karl Kashofer3, Geraldine Zenz2
1CBmed GmbH-Center for Biomarker Research in Medicine, Stiftingtalstrasse 5, 8010, Graz, Austria.
Purpose:
Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure.
Methods:
The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts.
Results:
Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery.
Conclusions:
There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.
Related Concept Videos
Drug-Receptor Interaction: Antagonist
Antagonists can be classified as competitive or noncompetitive based on their...
Antibiotic Selection
Cholinergic Antagonists: Pharmacokinetics
Cholinergic Antagonists: Therapeutic Uses
Respiratory Tract: Ipratropium, aclidinium, and tiotropium treat asthma, chronic bronchitis, and chronic obstructive pulmonary disease (COPD). They protect against bronchoconstriction caused by irritants like cigarette smoke, sulfur dioxide, and ozone. They also help reduce nasopharyngeal...
Cholinergic Antagonists: Pharmacological Actions
Gastrointestinal Effects: Antimuscarinics reduce gut contractions, increase gastric emptying, and slow intestinal transit. They partly inhibit gastric acid secretion...
Development of Antibiotic Resistance

