Diversity of ATM gene variants: a population-based genome data analysis for precision medicine

Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established.

Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants.

We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality.

The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.