Related Experiment Video
Updated: Dec 23, 2025

Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells
Published on: January 17, 2019
Finding of novel telomeric repeats and their distribution in the human genome
Sathyalakshmi Alaguponniah1, Deepa Velayudhan Krishna1, Sayan Paul2
1Centre for Information Technology & Engineering, Manonmaniam Sundaranar University, Tirunelveli, Tamilnadu 627012, India.
Abstract:
Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.
Related Concept Videos
Telomeres and Telomerase
Telomeres and Telomerase
Replication in Eukaryotes
Replication in Eukaryotes
Many Proteins Orchestrate Replication at the Origin
Eukaryotic replication follows many of the same...
Non-LTR Retrotransposons
Chromosome Replication

