Related Experiment Video
Updated: Dec 16, 2025

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila
Published on: August 20, 2019
Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual
Lily Zhang1, Xiao Mao2, Hongyu Long1
1Neurology Department, Xiangya Hospital, Central South University, Changsha, China.
Abstract:
Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.
More Related Videos
09:37Navigating MARRVEL, a Web-Based Tool that Integrates Human Genomics and Model Organism Genetics Information
Published on: August 15, 2019
08:22A Novel Strategy Combining Array-CGH, Whole-exome Sequencing and In Utero Electroporation in Rodents to Identify Causative Genes for Brain Malformations
Published on: December 1, 2017
Related Concept Videos
Pleiotropy
Incomplete Dominance
Lethal Alleles
Lucien Cuénot discovered lethal alleles in 1905 while studying the inheritance of coat color in mice. The agouti gene is responsible for the color of the coat in mice. This gene codes for an agouti-signaling protein, which is responsible for melanin distribution in mammals. The wild-type allele gives rise to gray-brown coat color in mice, while the mutant allele gives rise to yellow coat color. In addition to coat color, the agouti gene is associated with the yellow...
Genomic Imprinting and Inheritance
The expression of some genes depends on which parent passed the gene to the offspring, through a phenomenon known as...
Genetic Lingo
Epistasis