Related Experiment Video
Updated: Aug 13, 2026
15:22
Nucleoside Triphosphates - From Synthesis to Biochemical Characterization
Published on: April 3, 2014
alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides
F Morvan1, B Rayner, J P Leonetti
1Laboratoire de Chimie Bio-Organique, UA 488 CNRS, Montpellier, France.
Nucleic Acids Research
|February 11, 1988
Summary
Researchers developed an efficient solid-phase synthesis for unnatural alpha-anomeric oligodeoxyribonucleotides. This method enables rapid production of custom DNA sequences up to 20 units long with high purity.
Area of Science:
- Synthetic organic chemistry
- Oligonucleotide synthesis
- Biochemistry
Background:
- Alpha-anomeric oligodeoxyribonucleotides are unnatural nucleic acid analogs with potential therapeutic applications.
- Efficient synthesis methods are crucial for their further investigation and development.
- Existing methods may be limited in scope or efficiency.
Purpose of the Study:
- To describe an efficient solid-phase procedure for synthesizing alpha-anomeric oligodeoxyribonucleotides.
- To demonstrate the utility of alpha-nucleoside phosphoramidites and derivatized solid supports.
- To produce and characterize specific unnatural alpha-oligodeoxyribonucleotides.
Main Methods:
- Solid-phase synthesis utilizing alpha-nucleoside phosphoramidites.
- Employing alpha-nucleoside derivatized solid supports for the four natural bases.
- High-performance liquid chromatography (HPLC) for purification.
- Maxam-Gilbert sequencing for primary structure determination.
Main Results:
- Successful synthesis of alpha-anomeric oligodeoxyribonucleotides up to 20 units in length.
- Obtained a 15-mer (alpha-d(CCTCTCGTTCTTTAC)) in 27% overall yield.
- Obtained a 20-mer (alpha-d(ATACTTGAGGAAGAGGTGTT)) in 29% overall yield.
- Confirmed purity, nucleoside composition, and primary structure via HPLC and sequencing.
Conclusions:
- The described solid-phase procedure is efficient for synthesizing unnatural alpha-anomeric oligodeoxyribonucleotides.
- The method allows for rapid and reliable production of defined-length alpha-oligodeoxyribonucleotides.
- The synthesized compounds were thoroughly characterized, validating the procedure.
Related Concept Videos
01:22Preparation of 1° Amines: Azide Synthesis
Direct alkylation of ammonia produces polyalkylated amines, along with a quaternary ammonium salt. To exclusively prepare primary amines, the azide synthesis method can be used.
Azide ions act as good nucleophiles and react with unhindered alkyl halides to form alkyl azides. Alkyl azides do not participate in further nucleophilic substitution reactions, thereby eliminating the chances of polyalkylated products. Alkyl azides are reduced by hydride-based reducing agents, like lithium aluminum...
Azide ions act as good nucleophiles and react with unhindered alkyl halides to form alkyl azides. Alkyl azides do not participate in further nucleophilic substitution reactions, thereby eliminating the chances of polyalkylated products. Alkyl azides are reduced by hydride-based reducing agents, like lithium aluminum...
01:28Preparation of 1° Amines: Gabriel Synthesis
Direct alkylation is not a suitable method for synthesizing amines because it produces polyalkylated products. Gabriel synthesis is the most preferred method to exclusively make primary amines. The method uses phthalimide, which contains a protected form of nitrogen that participates in alkylation only once to predominantly give primary amines.
Strong bases like NaOH or KOH deprotonate the phthalimide to form the corresponding anion, which acts as a nucleophile. Further, the anion attacks an...
Strong bases like NaOH or KOH deprotonate the phthalimide to form the corresponding anion, which acts as a nucleophile. Further, the anion attacks an...