Related Experiment Video
Updated: Oct 4, 2025
Author Spotlight: Unveiling the Role of TMOD3 in Platinum Resistance and Immune Infiltration in Ovarian Cancer
Published on: August 2, 2024
The antitumor effect of miR-448 in epithelial ovarian cancer
Tao Li1, Jialing Yuan1, Yi Lai1
1Key Laboratory of Birth Defects and Related Diseases of Women and Children (Sichuan University), Ministry of Education, West China Second Hospital, (and The State Key Laboratory of Biotherapy, West China Hospital), Sichuan University, Chengdu, China.
Background:
Ovarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood.
Methods:
The miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays.
Results:
In this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2.
Conclusions:
Our study suggests that miR-448 has an inhibitory role in OC.
Insights
microRNA-448 (miRNA-448) is downregulated in ovarian cancer (OC), correlating with reduced survival. Restoring miRNA-448 inhibits cancer cell proliferation and promotes apoptosis by targeting ZEB2.
Area of Science:
- Oncology
- Molecular Biology
- Genetics
Background:
- Ovarian cancer (OC) is a leading cause of cancer death globally and in China.
- Current targeted therapies like bevacizumab and PARP inhibitors have limitations.
- MicroRNAs (miRNAs) are emerging as crucial biomarkers and therapeutic targets in OC.
Purpose of the Study:
- To investigate the role of miRNA-448 in ovarian cancer.
- To determine the molecular mechanisms underlying miRNA-448's function in OC.
Main Methods:
- Quantitative real-time PCR (qRT-PCR) to measure miR-448 expression in OC tissues and cell lines.
- Transfection with miR-448 mimics or antisense oligonucleotides to modulate miR-448 levels.
- Cell proliferation assays (MTT) and apoptosis assays (Annexin V-FITC/PI).
- Dual-luciferase reporter assays to identify miR-448 targets.
Main Results:
- miR-448 expression was significantly lower in epithelial ovarian cancer (EOC) tissues compared to normal tissues.
- Low miR-448 expression correlated with a poorer survival rate in OC patients.
- miR-448 directly targets the 3'UTR of ZEB2, inhibiting its expression.
- Overexpression of miR-448 suppressed cell proliferation and induced apoptosis in OC cells.
Conclusions:
- miR-448 functions as a tumor suppressor in ovarian cancer.
- Targeting miR-448 may represent a novel therapeutic strategy for OC.
