Related Experiment Video
Updated: Aug 22, 2025

Measurement of Factor V Activity in Human Plasma Using a Microplate Coagulation Assay
Published on: September 9, 2012
Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report
Xinwei Hou1,2, Kairu Zhang2,3, Qian Wu2,4
1Department of Oncology, Haihe Hospital, Tianjin University, Tianjin, China.
Rationale:
Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia.
Patient Concerns:
A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain.
Diagnoses:
The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4).
Interventions:
An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy.
Outcomes:
The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed.
Lessons:
By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.
Related Concept Videos
Anticoagulant Drugs: Low-Molecular-Weight Heparins
Disorders of Hemostasis
Thromboembolic Disorders
Two factors primarily cause thromboembolic conditions.
Venous Thrombosis I: Introduction
Pedigree Analysis
Extrinsic and Intrinsic Pathways of Hemostasis
The Extrinsic Pathway
The extrinsic pathway of coagulation is typically initiated by tissue damage that exposes blood to tissue factor (TF), a protein released by the damaged tissue cells outside the blood vessels—this interaction with TF triggers biochemical reactions involving specific clotting factors. The key player here is Factor VII, which...
Venous Thrombosis III: Interprofessional Care

