Related Experiment Video
Updated: Aug 4, 2026

Microwave Assisted Rapid Diagnosis of Plant Virus Diseases by Transmission Electron Microscopy
Published on: October 14, 2011
Occurrence of Watermelon silver mottle virus in Peanut in China
Biao Hu1, Zhongtian Xu2, Zhongyan Wei3
1Ningbo University, 47862, Ningbo, China; hubiao19990824@163.com.
Abstract:
Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 μg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.
More Related Videos
09:44RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem
Published on: December 21, 2015
10:24Author Spotlight: Quantification of Aflatoxins and Phytoalexins in Peanut Seeds to Identify Genetic Resistance Against Aspergillus
Published on: April 19, 2024
Related Concept Videos
Transgenic Plants
The first-ever transgenic plant was a tobacco plant developed in 1983 that showed resistance against the tobacco mosaic virus. Since then, many transgenic plants have been developed and commercialized for improving the agricultural, ornamental, and horticultural value of a crop plant. Transgenic...
Yellow Fever