Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families
Xiuqin Bao1,2,3, Danqing Qin1,2,3, Jicheng Wang1,2,3
1Medical Genetic Center, Guangdong Women and Children Hospital, Xingnan Road 521, Guangzhou, 510010, Guangdong, People's Republic of China.
Background:
β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.
Results:
In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major.
Conclusion:
Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.
More Related Videos
Related Concept Videos
01:31Translation
Translation is the process of synthesizing proteins from the genetic information carried by messenger RNA (mRNA). Following transcription, it constitutes the final step in the expression of genes. This process is carried out by ribosomes, complexes of protein and specialized RNA molecules. Ribosomes, transfer RNA (tRNA), and other proteins produce a chain of amino acids—the polypeptide—as the end product of translation.
Translation Produces the Building Blocks of...
02:18Alternative RNA Splicing
There are five types of alternative RNA splicing that vary in the ways the pre-mRNA segments are removed or retained in the mature mRNA. The first...
01:11Genetic Lingo
01:27Glucose Transporters
Facilitated diffusion-glucose transporters (GLUTs) are encoded by the solute-linked carrier (SLC) family 2, subfamily A gene family, or SLC2A. The 14 GLUT protein members are distributed into three classes:
01:39Mutations
02:46Genome Copying Errors