The nucleotide sequence of bacteriophage T5 leucine tRNA

Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh. This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively.