Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans

Area of Science:

• Molecular Biology
• Genetics
• Developmental Biology

Background:

• CRISPR/Cas9 genome editing is a routine technique in *C. elegans* research for generating mutants and tagging genes.
• The efficiency of single-guide RNA (sgRNA) sequences in CRISPR experiments can be highly variable.
• Using an intermediate entry strain with an efficient sgRNA, like the *dpy-10* guide RNA, is a common strategy to improve knock-in efficiency.

Purpose of the Study:

• To address the limitations of the *dpy-10* guide RNA for creating CRISPR entry strains in *C. elegans*.
• To introduce a novel, synthetic sgRNA sequence as a viable alternative for generating entry strains.
• To provide a robust tool for *C. elegans* genome editing, especially in cases where the *dpy-10* sequence is not applicable.

Main Methods:

• Design and synthesis of a novel sgRNA sequence (GCTATCAACTATCCATATCG) not present in the *C. elegans* genome.
• Utilizing the synthetic sgRNA to create intermediate entry strains in *C. elegans* via CRISPR/Cas9.
• Evaluating the knock-in efficiency of the synthetic sgRNA for entry strain generation.

Main Results:

• The synthetic guide sequence, GCTATCAACTATCCATATCG, demonstrated successful generation of entry strains in *C. elegans*.
• Knock-in efficiency for the synthetic sgRNA ranged from 1-11%, which is lower than the *dpy-10* method but sufficient for many applications.
• The synthetic sgRNA is effective even when the *dpy-10* sequence is unsuitable due to genetic linkage or co-CRISPR marker requirements.

Conclusions:

• A novel synthetic sgRNA sequence offers a valuable alternative for creating *C. elegans* entry strains.
• This new tool expands the utility of CRISPR/Cas9 genome editing in *C. elegans*, particularly in challenging genetic contexts.
• The synthetic sgRNA enhances the CRISPR toolkit for researchers needing flexible and robust genome engineering strategies.