Molecular Dynamics Simulation-Assisted siRNA Design for Dual-Ubiquitinated SKP2 Silencing via Ago2 Anchoring in...

S-phase kinase-associated protein 2 (SKP2) functions as a dual-ubiquitin modulator in breast cancer progression by orchestrating two distinct ubiquitination process. Through Ub-K48-linked degradation, SKP2 facilitates proteasomal turnover of tumor suppressors while Ub-K63-linked modification amplifies oncogenic signaling cascades. Together, these mechanisms drive uncontrolled cell proliferation, enhance metastatic potential, and contribute to therapeutic resistance. To therapeutically intercept SKP2, this study employed a consolidated structural informatics framework to rationally design small interfering RNAs (siRNAs) with high target specificity. Commencing with a curated library of 127 siRNA sequences, a multiparametric filtration cascade of thermodynamic profiling, secondary structure interrogation, and genome-wide off-target exclusion refined the pool of eight high-confidence siRNA candidates. These were further subjected to binding against human Argonaute 2 (hAgo2), a catalytic epicenter of the RNA-induced silencing complex (RISC). Interestingly, siRNA 10 and siRNA 11 emerged as lead candidates, exhibiting robust binding affinities, precise spatial accommodation within the Ago2 binding cleft, and predicted silencing efficiencies of 96.5%. To further assess their dynamic stability and conformational behavior, all-atom molecular dynamics simulations were performed to both bound and unbound siRNA with the Ago2 complex using the CHARMM-GUI interface and CHARMM36m force field, optimized for RNA-protein interactions. We report our designed siRNA 10 (5'AUCACUUAAGUCUAGAUGGAC'3) and siRNA 11 (5'UAUCACUUAAGUCUAGAUGGA'3) for precise silencing of SKP2, offering a targeted therapeutic avenue to disrupt dual-ubiquitin-driven oncogenic progression in breast cancer.