HNRNPF-driven retention of exon 14 in HIF1A pre-mRNA promotes breast cancer metastasis

Hypoxia-inducible factor 1-alpha (HIF1A) is a core regulator of cellular adaptation to hypoxic environments and is extensively involved in various cancer processes. Although it is known that HIF1A produces two isoforms, HIF1A-L and HIF1A-S, through the alternative splicing of exon 14, the specific functional differences between these isoforms in cancer development and progression remain unclear, and the molecular mechanisms regulating this exon skipping event have yet to be elucidated. Clinical IHC and FISH analyses demonstrate that HIF1A-L expression is elevated in high-grade breast cancer tissues and correlates with malignant progression. Using transcriptomics and functional assays, we demonstrate that HIF1A-L enhances, while HIF1A-S inhibits, cancer cell proliferation, migration, and invasion. Mechanistically, through luciferase reporter and Western blot analyses, we found that HIF1A-L upregulates CXCR4 to activate the AKT pathway, whereas HIF1A-S antagonizes this axis. Furthermore, via CL-RIP, MS2-RIP, and RNA-pull down assays, we identify the RNA-binding protein HNRNPF as the key upstream regulator that specifically binds to a conserved G-rich sequence (gggaggtggaggttgcgatgagctgagatcagg) within intron 13 of HIF1A pre-mRNA to promote exon 14 retention and HIF1A-L production. Critically, in vivo metastasis assays in nude mice reveal that knockdown of HNRNPF or HIF1A-L suppresses lung metastasis, along with reduced CXCR4 in lung tissues and lower serum levels of the pro-metastatic cytokines IL-6 and CXCL12, whereas knockdown of HIF1A-S exacerbates metastasis. This study elucidates the HNRNPF/HIF1A-L/CXCR4/AKT axis as a central regulatory circuit controlling breast cancer metastasis and suggests that correcting the aberrant splicing of HIF1A may represent a novel therapeutic strategy for cancer.