Muscle-Derived Small Extracellular Vesicles Regulate Bone Maintenance During Hibernation Through miRNA-Mediated...

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle-bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen's d = 0.71, 95% CI [-0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis.