Related Experiment Videos

Phosphoglucomutase: evidence for a new locus expressed in human milk

J M Cantu, B Ibarra

Science (New York, N.Y.)

|May 7, 1982

Abstract:

Electrophoretic study of phosphoglucomutase (PGM) in human milk revealed different patterns that can be explained by the existence of a locus distinct from the common PGM1, PGM2, and PGM3. One hundred and forty samples were tested and the results showed four different alleles of PGM4 whose frequencies were under Hardy-Weinberg equilibrium.

Related Concept Videos

Articles linked to this work by shared authors, journal, and citation graph.

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection.

Revista espanola de cirugia ortopedica y traumatologia (English ed.)·2019

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

International journal of paleopathology·2018

Sorption of Cr(III) and Cr(VI) to K2Mn4O9 nanomaterial a Study of the effect of pH, time, temperature and interferences.

Microchemical journal : devoted to the application of microtechniques in all branches of science·2017

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

International journal of laboratory hematology·2017

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

International journal of pharmaceutics·2017

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

International journal of laboratory hematology·2016

See all related articles